Primer Tm Calculator
Calculate a PCR primer’s melting temperature with the Wallace rule and the salt-adjusted formula, plus GC content, molecular weight and reverse complement.
What Tm means
The melting temperature, Tm, is the temperature at which half of a primer’s copies are bound to their complementary sequence and half are free. It sets the annealing temperature in PCR: too high and the primer barely binds, too low and it binds to partly matching sites and amplifies the wrong products. G·C base pairs are held by three hydrogen bonds and stack more strongly than A·T pairs with two, so GC-rich primers melt at higher temperatures. Longer primers melt higher too, and salt stabilises the duplex by shielding the negatively charged backbones.
Two quick formulas
The Wallace rule, Tm = 2 °C × (A + T) + 4 °C × (G + C), was devised for short probes hybridising to membranes and works reasonably for primers under about 14 bases. For longer primers, a salt-adjusted formula is better: Tm = 81.5 + 16.6 log₁₀[Na⁺] + 0.41 × %GC − 600 ÷ N, with the sodium concentration in mol/L and N the length. The M13 reverse primer, AGCGGATAACAATTTCACACAGGA, is 24 bases with 10 A, 5 C, 5 G and 4 T, so its GC content is 41.7%. The Wallace rule gives 68 °C, an overestimate at this length, and the salt-adjusted formula at 50 mM Na⁺ gives 52.0 °C. Its molecular weight, by the anhydrous formula used by OligoCalc, is 7,378.9 g/mol, and its reverse complement is TCCTGTGTGAAATTGTTATCCGCT.
Nearest-neighbour and real conditions
Both quick formulas ignore the order of bases, which matters: GC-rich stretches at one end bind differently from GC spread evenly. Nearest-neighbour methods sum measured stacking energies for each adjacent pair of bases and give better estimates, typically within 1 to 2 °C of experiment. Real PCR buffers also contain magnesium, which stabilises duplexes much more than sodium, and the primer concentration matters. That is why primer design software and polymerase manufacturers’ calculators can give Tm values several degrees apart for the same primer; they use different models and buffer assumptions. A common mistake is to compare a Tm from one tool with an annealing recommendation written for another.
Designing a primer pair
As guidelines, primers of 18 to 25 bases with 40% to 60% GC and Tm values within about 2 to 5 °C of each other work well, with a G or C at the 3′ end, a GC clamp, but not more than three G or C in the last five bases. Avoid runs of four or more of one base and sequences that pair with themselves or each other. A common starting point is an annealing temperature 3 to 5 °C below the lower Tm, then optimising with a gradient PCR.
How to use it
- Paste the primer sequence 5′ to 3′ using A, C, G and T; spaces and numbers are ignored.
- Enter the monovalent salt concentration, typically 50 mM.
- Read the Tm, GC content, molecular weight and reverse complement.
- Compare both primers of a pair with the same method and adjust the annealing temperature by experiment.
Questions from the teaching lab
How do you calculate primer Tm?
For short primers under about 14 bases, use the Wallace rule: 2 °C for each A or T plus 4 °C for each G or C. For longer primers, use a salt-adjusted formula such as 81.5 + 16.6 log₁₀[Na⁺] + 0.41 × %GC − 600 ÷ length, or a nearest-neighbour calculator.
What is a good GC content for a PCR primer?
Between about 40% and 60%. Lower GC content needs longer primers to reach a useful Tm; higher GC content increases the risk of non-specific binding and secondary structures. A G or C at the 3′ end helps the primer bind firmly where extension begins.
Why do different Tm calculators give different results?
They use different formulas and assume different salt, magnesium and primer concentrations. Simple formulas ignore base order, while nearest-neighbour methods include it. Compare primers using the same tool, and use the polymerase manufacturer’s calculator for its own buffer.
What annealing temperature should I use for PCR?
A common starting point is 3 to 5 °C below the lower Tm of the two primers, then optimising with a temperature gradient. Some high-fidelity polymerases recommend annealing at or above the Tm calculated with their own method; follow the enzyme’s protocol.
Disclaimer: Genetics results apply textbook models, Mendelian ratios, Hardy-Weinberg equilibrium and simple Tm formulas, to the values you enter. They are for education and are not medical advice, genetic counselling or parentage testing. Real inheritance involves linkage, variants and family history these models leave out: anyone concerned about a condition, a pregnancy or a test result should speak to a doctor or genetic counsellor.